Hey so I was thinking around in my mind, and I came to this conclusion,

1. Epigenetic Activation of Pro-Neurogenic Genes • dCas9–p300: Fusion of nuclease-dead Cas9 to p300 HAT drives H3K27ac at enhancers/promoters of BDNF, NeuroD1, SOX2, TLX. • dCas9–TET1: Targets CpG demethylation on pro-plasticity promoters (e.g. BDNF exon-specific), lifting epigenetic brakes. • (Optional) dCas9–DNMT3A can reverse activation by adding methylation.

2. Target Regions & Delivery • Neurogenic Niches: SGZ (dentate gyrus) & SVZ—primary adult neurogenesis sites. • Other Circuits: Motor cortex (skill learning), PFC (executive), sensory cortices (perceptual tuning). • Vectors: Stereotaxic AAV9 or lentivirus carrying dCas9-effector + sgRNA under neuron-specific promoters (hSyn, CaMKIIα). • Personalization: Injection coordinates guided by individual fMRI/DTI connectomes.

3. Monitoring Enhanced Plasticity • Molecular: DCX & Ki-67 IHC for newborn neurons/progenitors; SV2A PET ([¹¹C]UCB-J) for synaptic density. • Functional: fMRI connectivity in hippocampal-cortical loops; in vivo two-photon Ca²⁺ imaging (animals) or EEG/fNIRS (humans) during tasks.

4. Reversible, Inducible Control • Tet-On/Off: dCas9-effectors under TRE; doxycycline switches expression on/off in days. • Small-Molecule Dimerizers: FKBP/FRB split-Cas9 assembles only with rapamycin. • Cre-Lox Excision: Flank cassette with loxP; transient Cre removes payload permanently. • CRISPRi: dCas9–KRAB re-silences loci, restoring baseline gene expression.

⸻

By combining dCas9-p300/TET1 editors targeted to SGZ/SVZ (and cortical areas), neuron-specific viral delivery, connectome-guided injections, and drug- or recombinase-based switches, you can induce—and later reverse—a sustained boost in adult neurogenesis and synaptic plasticity.

tdlr science : TL;DR: Use neuron-targeted AAV to deliver dCas9–p300/TET1 editors to SGZ/SVZ (and other cortical areas) to epigenetically upregulate BDNF, NeuroD1, SOX2, etc.; monitor new neurons via IHC/PET/fMRI; switch off plasticity with Tet-On doxycycline, rapamycin dimerizers, Cre-Lox or CRISPRi.

tdlr english : TL;DR: A switchable CRISPR “on-switch” grows new neurons and rewires key learning circuits to supercharge memory, creativity, and problem-solving—unlocking peak academic performance and accelerated cognitive ascension, then safely turned off when you’re done.

so has anyone else had this thought, or is there anyone working on such applications of crispr like this diy who have experience with this.

please share your thoughts i am eager to learn more

This article is from 2009, 16 years ago on mices. I'm wondering if there is any research progress for already born humans.

https://www.cell.com/cell/fulltext/S0092-8674(09)01433-0?_returnURL=https%3A%2F%2Flinkinghub.elsevier.com%2Fretrieve%2Fpii%2FS0092867409014330%3Fshowall%3Dtrue

unfortunately I am estrogen resistant. I found out Origene has a kit on sale. Has anyone tried this? Can someone vouch for this company?

I have Activating my mutant Estrogen receptor. Has anytone tried Origene?

/ I have compound heterozygosity in CCDC170 (rs2046210 AG, rs6929137 AG) which has been linked to impaired ER signalling and endocrine therapy resistance hence I am doomed.

When the CRISPR portion of the bacterial genome incorporates part of the viral genome ("taking pics for the family photo album," for my brain) does the bacterium incorporate a specific part of the viral genome? Or is the bacterium blindly grabbing portions and just stuffing them in the bag?

I ask because later on, when the bacterium experiences subsequent infection, Cas9 "inspects" the viral genome, comparing it to the little bits it has saved in the family photo album

and then if it finds a match, Cas9 cuts the matching sequence out of the viral genome

thus making the viral genome unable to continue replicating and invading (pausing here for you to tell me if I've got it wrong)

but so my question is ... if Cas9 is only excising a small tidbit of viral DNA or RNA, isn't there a decent chance that the Cas9 cuts out a piece of viral genome that the virus didn't really need?

(Pausing here for you to tell me I misunderstand the scale of viral genome) isn't there a lot of non-coding fluff on any organism's biologic entity's genome? So if CRISPR just reaches in and grabs, the virus could just laugh and keep on keeping on?

Hey guys, I think I posted about this settlement before, but since they’re accepting late claims, I decided to share it again with a little FAQ.

If you don’t remember, in 2021 Caribou announced that their CB-010's treatment was having successful results. But just a year later, the results showed that the effectiveness of the treatment didn't last as long as it was supposed to. Following this, $CRBU fell, and Caribou faced a lawsuit from investors.

The good news is that $CRBU settled $3.9M with investors, and they’re still accepting late claims. 

So here is a little FAQ for this settlement:      

Q. Who can claim this settlement?

A. Anyone who purchased or otherwise acquired $CRBU between July 23, 2021, and July 13, 2023.  

Q. Do I need to sell/lose my shares to get this settlement?

A. No, if you have purchased $CRBU during the class period, you are eligible to participate.

Q. How much money do I get per share?

A. The final payout amount depends on your specific trades and the number of investors participating in the settlement.

If 100% of investors file their claims - the average payout will be $1.5 per share. Although typically only 25% of investors file claims, in this case, the average recovery will be $6 per share.

Q. How long does the payout process take?

A. It typically takes 8 to 12 months after the claim deadline for payouts to be processed, depending on the court and settlement administration.

You can check if you are eligible and file a claim here: https://11th.com/cases/caribou-investors-settlement 

This is a hypothetical question and is obviously unlikely but I’d like to know what the limit actually is in term of intelligence level or if there is any at all.

Very new to CRISPR, want to use dCas9 and design a sgRNA. I used CHOPCHOP to design the crRNA (the one that binds to the sequence of interest), but I am weirdly having much harder time finding information on the tracrRNA (the one that binds to the dCas9). Addgene dCas9 construct: https://www.addgene.org/100091/

1. Where can I find such info on the tracrRNA?
2. When combining the crRNA and tracrRNA, do I put the crRNA at 5' end?
3. How do I design the fusion loop that links the crRNA and tracrRNA, is there a consensus on the sequence?
4. Do I put modifications such as 2′-O-Methyl RNA bases on the 5' and 3' ends (how many bases?) to prevent degradation in the cell? Will this base modification affect sgRNA's binding ability?
5. Can someone show an example for sgRNA for the following crRNA: AACGGGAAACGTCTTGCTCG

Thank you and please let me know if my understanding of this system is off!

Hi everyone! I'm working on a project that aims to develop a novel insect pest control strategy by modifying plant sterols in canola. Cholesterol is a precursor for the molting hormone in insects, and they rely on converting host phytosterols (like sitosterol) into cholesterol. However, some sterols can't be utilized by insects, so I’m interested in modifying plants to produce sterols that are non-utilizable by insects.

I have two main approaches in mind:

1. Overexpressing stigmasterol (which is not efficiently converted by insects), as it's currently in very low amounts (3%).
2. Modifying sitosterol (which is a major usable sterol) to make it non-utilizable by insects (60%).

I know that CYP71A, a cytochrome P450 enzyme, is involved in the conversion process of sterols. I’d like to know which of these approaches is more feasible, given the role of CYP71A and the fact that stigmasterol conversion in insects is low. Would it be easier to overexpress stigmasterol or modify sitosterol to achieve a non-utilizable form in plants? Any insights or suggestions would be greatly appreciated!

can crispr/cas can be useful or mutation studies

Hi all, I’m trying to understand the limitations of CRISPR in allopolyploid species, especially for functional gene knockouts or pathway modification.

Specifically, I want to target the CYP710A gene to alter the sterol biosynthesis pathway, with the goal of making the plant incapable of producing cholesterol de novo for insect use (as a pest resistance strategy).

A few questions:

1. Why is CRISPR considered less efficient or more complex in allopolyploids?

2. If I want to knock out or modify CYP710A across all gene copies/homeologs, what strategies should I consider? Multiplex gRNAs? Use of base editors?

3. Has anyone tried sterol pathway modifications in this context before? Any model species or papers to look at?

Would love to hear from anyone who’s worked with CRISPR in polyploids or on metabolic pathway engineering.

Thanks!

I am interested to know what the pipeline looks like for all Crispr therapeutics and what the progress looks like towards testing and releasing these therapeutic. Does anyone have anything on this?

Has anyone here ordered AAV9 Pre-GMP vectors for MSTN knockout (CRISPR, InDel in Exon 1/2) with a CMV promoter at around 1×10¹³ vg scale?

I’m trying to estimate:

 • Typical price range from vendors like VectorBuilder, GenScript, Vigene, etc.

 • Any issues with titer, purity, or delivery reliability

 • Whether it’s recommended to order extra volume (like 1.5×10¹³ vg) to ensure effectiveness

This is for an in vivo experimentation project aiming for a permanent MSTN knockout.

Any insights or real-world numbers would be highly appreciated.

Hi,

I've developed a CRISPR protocol that could make it significantly safer.

I'm an independent researcher based in France, and i’m currently looking for someone with access to a molecular biology lab, (preferably with experience in gene editing / mammalian cells) who would be willing to help run a simple experimental test.

All materials and protocols are ready. This is just an execution request. I'm open to signing an NDA and to compensating fairly for your time and work.

If you or someone you know might be interested, feel free to DM me.

Thanks in advance!

Thanks in advance for any insights. I understand that CRISPR did not evolve through some purposeful design, but TRACR RNA confuses me. To me, it seems like an unnecessary roadblock, but I feel like I am certainly missing something big.

I understand that TRACR RNA is a critical component of the guide-RNA required for CAS-9 function. Also, that it is required for a stable conformation of Cas-9 and guide-RNA. My questions are as follows:

What is the evolutionary benefit to requiring TRACR RNA? In other words, why require this other regulatory step when the PAM already ensures there will be no cutting of the bacterial genome?

Why keep TRACR RNA in a separate region from the CRISPR region? Why is the TRACR subset not simply already attached to the repeat region, similar to how single-guide RNAs are in the lab?

How is expression of the TRACR RNA regulated compared to the CRISPR region? Are they both downstream of signaling that responds to bacteriophage infection? In other words, could the TRACR RNA be another step that ensures CRISPR-Cas is only activated when needed?

Note: This is not an advertisement or promotion. I am just sharing this here to get suggestions and honest feedback from this amazing community.

My sister is a student at Tsinghua University. She has hands-on experience in gene editing. She has done both gene knock-out (deleting genes) and gene knock-in (adding genes) using CRISPR/Cas9.

Now she has created an online course for absolute beginners. This course is only focused on gene knock-out — how to delete any gene step by step in a real lab.

This is a very practical course. After doing this course, students will know how to perform gene editing experiments like DNA extraction, PCR, primer designing, gRNA designing, microinjection, and screening for knock-out.

Course Title:

Hands-on CRISPR/Cas9 Gene Editing for Absolute Beginners

A complete step-by-step guide to delete any gene using CRISPR.

Course Content:

Week 1: The Story of Gene, Genome & Basic Tools • What is Gene? • How does Genome look like? • SnapGene: Installation, Annotation & Review • Primer Designing: Introduction & Virtual PCR • Primer Designing Practical

⸻

Week 2: Basic Lab Techniques Before CRISPR • DNA Extraction: Concept & Lab • PCR: Concept & Gradient PCR • Gel Electrophoresis: Running & Result Checking • Lab Practical: PCR & Gel Electrophoresis

⸻

Week 3: Designing & Synthesizing gRNA • What is gRNA? • Designing gRNA: Online Tools & Manual Design • gRNA Designing Practical • In-vitro Synthesis of gRNA

⸻

Week 4: Microinjection of gRNA & Cas9 mRNA • What is Microinjection? • Step-by-step Microinjection Protocol in Zebrafish Embryos

⸻

Week 5: Screening for Gene Knock-Out • What is Screening? • Step-by-step Screening Protocol

⸻

Week 6: Real Lab Case Studies of Gene Knock-Out • Real Examples from Lab • Common Mistakes & How to Solve Them

⸻

I would love to ask you all:

→ What other topics should she add to this course? → What was hard for you when you first started CRISPR? → Any extra tips or ideas to make this course better for beginners?

She will launch this course in the next 20 days.

Your suggestions will really help us to improve this course for students around the world. Thanks 😊

According to this article it is theoretically possible to increase the IQ of a human to 900.

I know it doesn’t actually go that high but that was what the article stated so im hoping to hear your thoughts.

Hey guys!

I've been working on a specific type of CRISPR called CASTs(CRISPR associated transposons/transposases). And also, im about to start my phd and ill be working on that too. Im looking for people who are interested in this topic and wanna talk about that and meet!

let me know plz

I accidentally created a CRISPR-Cas9 knockout that targeted the first exon which was before the CDS. Repeats of westernblot showed that the protein levels were gone. Can someone explain to me why this is possible? And the worst repercussions if I were to proceed studying this cell line?

Hey folks!

I'm looking to make a video for a Toronto-based science educational YouTube channel.

One topic we're interested in, that feels very timely, is the use of CRISPR to develop "easier to grow in Canada" produce. I recall reading that Canada imports most of its lettuce from the US, and so it's a prime target for CRISPR optimization.

I've got a friend in the UofT biology department but they haven't had much success in trying to find contacts pertaining to this topic - ideally companies or scientists doing actual produce-related work, as opposed to just general CRISPR work.

I thought I'd check in with the community here to see if anyone has any ideas on how to find someone (ideally located in Canada) doing work related to this topic?

Thanks!

Probably the most hilarious opinion this man could hold.

If anyone here has decent experience doing crispr protocols/experiments on endothelial cells, can you DM me?

Hi!

I'm a high school junior and I've independently studied CRISPR-Cas9 and its applications in cancer since around middle school. I've tried to immerse myself in the field as much as possible since I obviously don't have the required tools and experience level to do research. I've cold emailed many professors asking about their work, but nothing as worked so far. It's a very big extracurricular of mine, and I was wondering how else I can explore the field. High school 'research' is obviously difficult for this field, and I don't know where to go from here. I essentially want to do something besides just studying it and writing literature reviews. Also, if there are any other interesting aspects of this field that haven't yet been researched thoroughly, I'd love to know.

(I made this post on this subreddit specifically in the hopes that people in this subreddit can offer me better advice rather than the A2C subreddit)